Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14881A1
Clone ID IST14881A1
Vector VICTR76
Project tigm

Sequence tag IST14881A1HMF1
Sequence
ACTCCCCTCCCTTGCTGAAAACCACTCCTCCCCTAACACCTGGAGCAAAGCANGTCTACCTTTCACTCNCTCGCCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 153973380..153973456 71
NO GENE  


Sequence tag IST14881A1HMR1
Sequence
NTCCNTAACTGCTTCATGTGCACCAAGCCCCCTTGTGGAATCCTGCTGAGAGTTTTTCTAGATGCCGTCNGTGAAACCNA
ACTGTTATAAAATCTTTTAGTTCACCAACTTTTATACACTAAAAACAAAGGGTGCTTGTTTCCTCCCCTTGTGGATTTTT
TTAAATGACTTTTTTTTGATTTTNAAGANCATTTTCTCAATGTATGCNTATTTACNAANAGACCN
Sequence Type genomic DNA
Unitrap ID UNI16428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58497291..58497513 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032336 (Nptn) NM_009145 neuroplastin Gene [Source:MGI Symbol;Acc:MGI:108077]

 
Come back to gene ENSMUSG00000032336


For any suggestions or comments, please send an email to unitrap@crg.es