Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15077F9
Clone ID IST15077F9
Vector VICTR80
Project tigm

Sequence tag IST15077F9HMF2
Sequence
NCCTTGCTCCCACGCGTGTTTGACTGCTTTTTGTTTGGTTTTGCTCTGTTGTTTCCCTCTATGTAATCCCAGCTATTGCT
CCATGGACCAGGTCA
Sequence Type genomic DNA
Unitrap ID UNI34670

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 138595437..138595529 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041143 (Tmco4) NM_029857 transmembrane and coiled-coil domains 4 Gene [Source:MGI (curated);Acc:Tmco4-001]


Sequence tag IST15077F9BBF1
Sequence
CGGACCTCCACCAGAGTTTCCTCTGGCTTCGCCCTGCCCAGGCATAGTTCACCATCTTTCGGGTCCTAACGCGTACGCTC
GTGCTCCACCTCCCCGGCGCGGCGGGCGAGACGGGCCGGTGGTGCGCCCTCGGCGGACTGGAGAGGCCTCGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391535..57391690 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]


Sequence tag IST15077F9HMR1
Sequence
TCCGTACGGTCCTGACNTGCAAATCGGTCGTCCGACCTGGGTATAGGGGCGAAAGANTAATCGAACCATCTANTAGCTGG
TTCCCTCCGAAGTTTCCCTCAGGATANCTGGCGCTCTCGCTCTTTTTTTCCCCGACGTACGCAGTTTTATCCGGTAAAGC
GAATGATTANAGGTCTTGGGGCCNAAACGATCTCANCCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGC
GTGGANCCGGGCGTGGAATGCNANTGCCTANNGGGCCNCTTTTGGTAANCANAACTGGCGCTGCGGGATGAACCGAACGC
CGGGTNAAGGCGCCCGANGCCGACGCTCATCANACCCCAGAAAAGGTGTTGGTTGATATANAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000075007


For any suggestions or comments, please send an email to unitrap@crg.es