Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13602G12
Clone ID IST13602G12
Vector VICTR74
Project tigm

Sequence tag IST13602G12HMR1
Sequence
TTTGGAATTTTACTTCTCTCTTGGACAAGAACTCAAGAACAAAATCCTCGGTGAGATTTCCCCTCCCCCCTCCCCCGCCC
TGGGAAGTTTGGTTCCCGGTCTTATCTAAAGACTTAATGTAAAGTTTTTATTTCTTTGCAAGGGGTGAGCCACAGAACGC
CTTTTCCCTAGGGGAGCAGTCGAGGTTTACCGCTTTGCTGTCCGGCCCTGGGGTGCAGACTGTGTCCCTCGCGACCGAGG
CCGAGGAGGGCAGTGCCACGAACTGCTCTCGCAAACTATGTCATCGGGTCCTCTGAAAGGATTTTGTTCNNNNNNACCTN
NNNNNNNTGNNNNAGAGAAAAANAACNTTTGTNTATCCNATTANAANCCNTTNTTCTGGANAAAGATATTTNNNANANCG
ANACCNTTGCTTGGNGTN
Sequence Type genomic DNA
Unitrap ID UNI30016

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4396053..4396360 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054611 (Fbxl11) NM_001001984 F-box and leucine-rich repeat protein 11 Gene [Source:MGI Symbol;Acc:MGI:1354736]

 
Come back to gene ENSMUSG00000054611


For any suggestions or comments, please send an email to unitrap@crg.es