Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14578D5
Clone ID IST14578D5
Vector VICTR74
Project tigm

Sequence tag IST14578D5BBF1
Sequence
GTATCTCTCATACAGGTCTTAAGCCTTCCTCAGACGAAACCTTGCTGAATGACCAACTCATAATCCCAAAGTACAAACAA
GAAAAAGCAAACAGGAACACAAATTAGGGTAAGACCCTTACAATCTACTGATAACAAAGCTGTGTTAAGGGTTAAAGTTC
TGTAAACTACAGAACTATCTCAAAGGATACAAAAACAAAAACCCCACACACATTCAAAATTCAAAACACAGGAGCTGGAG
AGATGGCTCAGGGGGCAAGAACACGGACTGCTCTTCCAGAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCAC
AACCACCCGTAGTGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106671761..106672101 341
 
EST/CDNA Est Name
  CJ110386.1 - CJ124665.1 - CJ077582.1 - CJ080617.1


Sequence tag IST14578D5HMF1
Sequence
NTNNNNNNCNNACNNGTCNNANNCNNNNNNNNNACNANNNCNTGCTGAATGACCNANTCANANNNNCNNNGTACAAACAA
GAAAAACCNNACNNGAACACNNATTANGGTAANACCCTTACANNCNACTGATAACNAAGCTGTGTTAANGGTNNNNNTTC
NNNNNNCTACNNAACTANCNCNNANGATACAAAANCNNANNCCCCACACACNTTCNAAATTNNAAACACANGANCNGGAN
ANATGGNNCANGGGGCNAGAACACNGANTGCTCNNCCANANGTCCNGANTTCNNATCCCAGCANCCNCATGGTGGCTCAC
ANCCNCCCGTAATGANATCTGAANCCCTCTTCTGGTGGGTCTGAANACAGCTACNGCNTACTCNCGTATAANANTANATC
TTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14578D5HMR1
Sequence
ATACCTTGCATTTGCTGTTAGGCAGCAAGGTGCATGCATCACTCACTGTGGGGCTACTGTAGTTTGCCTCTTGTTTTACG
CAGTATAGGTAGGTAAGTAAATACTTAAAACTCAGATN
Sequence Type genomic DNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106671648..106671764 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es