Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14803H5
Clone ID IST14803H5
Vector VICTR76
Project tigm

Sequence tag IST14803H5HMF2
Sequence
AACTCAGTTCCTCACGTTACACAGCAAGCACTCTAGCCACTGCTCCGTCTCTCCAGCCTTCAGCCACTTCTGGACAGGGC
TTTTGATGTAGCTTGGGGTAGCCTTGAACTCATGATCAGCCTCACTCAGCTTCCGGAGTGCTAGAGAGGCAAGCAGGAAC
CAGCAGCGGTGATGTCTCTGGCATTTCTGCATTACCTGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30265513..30265715 203
 
EST/CDNA Est Name
  CJ113409.1


Sequence tag IST14803H5HMR1
Sequence
NGTGGATCTGTGTGANTTCAAGGCCAGCCTGGTCTA
Sequence Type genomic DNA
Unitrap ID UNI10326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 6615027..6615061 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 57808850..57808884 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104310949..104310983 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032913 (Lrig2) NM_001025067 leucine-rich repeats and immunoglobulin-like domains 2 Gene [Source:MGI Symbol;Acc:MGI:2443718]


Sequence tag IST14803H5BBF1
Sequence
TGCGCCACATCGTTCACTTCCAAAGAAAGACTCTTATGCTCTGGATTATCTATTACTTTTACCAATGAAACTTGCCAAGA
TCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104311019..104311101 83
NO GENE  

 
Come back to gene ENSMUSG00000032913


For any suggestions or comments, please send an email to unitrap@crg.es