Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14629B7
Clone ID IST14629B7
Vector VICTR74
Project tigm

Sequence tag IST14629B7HMR1
Sequence
TTGGGAGTTGAATTTAGGATCTGTACTTGCTCCNGTTGGCCCTGCTCCCTCCANAAAAGGGCATCAGATTTCATTATGGG
TGGTTGTGAGCTACCAAGTGGTTGCTGGGATTTGAACTCAGGACCTTTGGGAAAGCAGTCNGTGTTCTTACCTGCTGANC
CATTTCACCANCCCTATTGTANTGGTTTGAATANATTTGGCCCCCATANATTCNTGTTTGGAATGCN
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108505182..108505407 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


Sequence tag IST14629B7BBF1
Sequence
TTCTGGCTATTATAAATAAGGCTGCTATGAACATAGTGGAGCATGTGTCCTTCTTACCGGTTGGGACATCTTCTGGATAT
ATGCCCAGGAGAGGTATTGCGGGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI35484

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 37761307..37761413 107
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 73441946..73442052 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062151 (Unc13c) NM_001081153 unc-13 homolog C (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2149021]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 5365158..5365264 107
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29476898..29477004 107
NO GENE  

 
Come back to gene ENSMUSG00000062151


For any suggestions or comments, please send an email to unitrap@crg.es