Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10671H10
Clone ID IST10671H10
Vector VICTR76
Project tigm

Sequence tag IST10671H10HMF2
Sequence
TTTCCCTCTCCCCTTTCTTCCAGATCCTTCCCTACCCCTCCTGGCTTTTTCAAATCCATGGCTTTTTTCCCTCTGTCCTT
ACATGTATATATGTATATGCATATATATATATATATTCCTAATTATANCCCGCACAGTTTGCATAANGAGCTGGCCNTTT
GCTATTGGATAACCNNTTTCTCAACCTTACTATTTGANACANGGCCTGTCACANCCTCGCGCTCACCANCTANTNANACT
AATTGCCTGATCANAGAGCTACCTGGATATTTCTGTCTTCTANTAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10671H10HMR1
Sequence
GAGCGAGGTGCTCACTAANCTGTANACCTTCGCCTCAGAGGAGATGGCAACTCTTCTCTTCATTCTCCTTGGCTTCTTGT
AACCCGAAGCTTGCTCAAGATCTGGAATTTCCAGGTGTTTCTCTGGGTGATCTGGATCTAAGAGGATACCAAGGAATGTG
GCCAG
Sequence Type genomic DNA
Unitrap ID UNI15535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165634620..165634783 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST10671H10BBF1
Sequence
GCTCCTCTGAANACTANAGCTCCANANTGAGAGAGCTACAGGGAAGCGGGGCTGGCTAGTCCCTTGGCTGGCCTGACTGA
CATACATCAGACCCTGGCTGCCCTGGGTATAGAAGCAACTCTGAACTTGTCCATGCTAGGCAGATGTGCCTAGCAGGGTT
CTAACAGGAAGCAGCTGCAGGGTGGCTTGTGCTGCTGCCGGTGACACAAATGTCATCAGGGCCTCAAGAAGGTCAGTTCC
CGCCGGGCAGTGGTGGTGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGAGGATTTCTGAGTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165634780..165635088 301
 
EST/CDNA Est Name
  AI427345.1 - CK622678.1 - AW762466.1 - W49202.1 - CA570198.1

 
Come back to gene AI427345.1 - CK622678.1 - AW762466.1 - W49202.1 - CA570198.1


For any suggestions or comments, please send an email to unitrap@crg.es