Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12516F3
Clone ID IST12516F3
Vector VICTR76
Project tigm

Sequence tag IST12516F3HMF1
Sequence
GTAACAAGACACTTTGGTCTTGAACAAGCCCTAGAGAACTTCCATACATGACACAGGGCCCTCTAGAATGCAAAAACAAA
AACACAAACTAACCCTGAAGTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23677521..23677622 102
NO GENE  


Sequence tag IST12516F3BBF1
Sequence
AGAGCACCCGACTGCTCTTCCAAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACAAG
ATCTTATT
Sequence Type genomic DNA
Unitrap ID UNI11991 UNI32895

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 63893633..63893719 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 82702082..82702168 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117444513..117444599 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64909005..64909091 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032393 (Dpp8) NM_028906 dipeptidylpeptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1921638]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 94689218..94689304 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23711438..23711524 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13143962..13144048 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72757075..72757161 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29611979..29612065 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053898 (Ech1) NM_016772 enoyl coenzyme A hydratase 1, peroxisomal Gene [Source:MGI (curated);Acc:Ech1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123842440..123842526 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 106557381..106557467 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 86728820..86728906 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 130624515..130624601 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32416883..32416969 85
NO GENE  

 
Come back to gene ENSMUSG00000053898


For any suggestions or comments, please send an email to unitrap@crg.es