Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10613F9
Clone ID IST10613F9
Vector VICTR76
Project tigm

Sequence tag IST10613F9HMF1
Sequence
GCTCACAACCATCTGTAATGAGATATGGTACCCTCTTCTGGTGTGTTTGAAGATAACTACAGTGTACTTACATATAATAT
AATAATAAATAAATCTTTTTAAAAGTCTAATAATAATAATATAAACAAAAATGGGAACAATAAAGGCATTTACCTCAGGC
ATTGTTGTGGGGTTACATAAAGTTTTTTGGATAATGGCTGATGTGATGGAAACACTCTGTAAATGTTAGCCNCTGGCATT
TTACAGAGGAGGACACTAANATGTAGAGAGAGACTTAAGTTGTTTGCCAAAAAGAAGTCACTAAAGGGGCTGGAGAGGTG
GCTCTGTGGGTAAGTACCCACATGGTGGTTACACTCATCTTTAACTCCAGTTCCNGGTGACCTGACACTCCACCAGGCAT
GCATGTGGTATACAAACACNTGTAGAAGCCACATGCTCACNTACATAAAATAGATAAATCTTAAAACAAANTTAAANGGC
CTCAAAGCCNGTNNGNACAGCTACCTGCCTAGCATTAAAACCTNGNCTGNNGANANGGNAN

Sequence Type genomic DNA
Unitrap ID UNI12960

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88349748..88350285 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008601 (Rab25) NM_016899 roadblock domain containing 3 Gene [Source:MGI (curated);Acc:Rab25-001]


Sequence tag IST10613F9BBF1
Sequence
ATCACCCTCCCTGTTTTGTTTTTTTTCANCCNNCCCTAAATTGGGGGAAGGAAGACTCCTTAAAGCCCCAGCCCTTGCCA
GGGATGGTGGCTCATTCGTTTCCAGCACTCGAGAGGCAGAGGCAGGCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132665696..132665828 127
NO GENE  

 
Come back to gene ENSMUSG00000008601


For any suggestions or comments, please send an email to unitrap@crg.es