Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14807G5
Clone ID IST14807G5
Vector VICTR76
Project tigm

Sequence tag IST14807G5HMF1
Sequence
AGACAAAACCTCTGAACCAGCCCAAATGAAGTGTTTTCCTTTATAAGAGTTGCTGTGGTCATGGTATCTCTCCACAGCAA
TAGAAACCCAAACTAAGACACCAACCCCATAACTTAGACCCTGAAGCAAATCCCTAGACCTAAAGTCTGTACATTTACGA
ACACTTGAAAACCCGTCCTACCATGTACTCCGGAAGACCACAGCTGTGAAAACGCCTTTAAAACTTATAGAAGCCATATG
TGATAGTGCAGGCTGCAATCCTAGCACTTGGCAGATGGAGCAGGAGGATTAGGATAGGAGCTGAAAGATCATTCTTGGTT
ACATAGCAAGTGTGGGAATAGCCTTGTTACATAATGAACCCTAGGCCATTCTGGGCACAGAGTGAGTGAGACCTTGCCTC
AAAAACAAAAAACAGGGCAGATAAGATGTAAAGGGGTTTGCTGCCNGAGGGGTTTGTGGACCTGANTTTGATCCCTANAN
TCCACTTGGTGGNNNNATTCCTGCAAGTTNTCCTCTTATCNCCNCNCNTATGCNNNNNGTACACAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51955828..51956374 511
NO GENE  


Sequence tag IST14807G5BBF1
Sequence
CCCTTTCAGTCACAGAGCTCAAAATAACCAAAATAAAGGCCAAATCTAGGAAGAGGCATTTTTTTCTTTTCAAGGCTTTA
ATGTATGACAACAATTCTCTAACATGGTGTCCACGCTTGGTCTGCTCCATCCTGCGTCACATGTATCAATGTCTGCCACA
GCACCATAGCATCCTCTGGCCTGTAGTATGACTGAAAGTTCTACACGCTCATTTTTCTAGGCTGTTACTTCTTCTTCTCG
GGTATTATTCACCACCTTCCAGCTTACGAGGTTTATCTACATCAACTTGTATCTCCAACGAGATAGCCACAGTTCTCTTC
TTGGTAGCAAACAACTTGGGGAACACCCCTGANCTATTGCCTCCTGGGTGGGCTCTTTTTAGCCCCTCTGCTTTCCTCTG
CTTCCAGCCCANGGCTCTTANANCANGAGGCCAAATGTGATACCTTCNCCACACCTACCACGTCGCANCTNTACCGTCCT
TCTTTCTCTNGGGAACTCNATACATTTAATTTTTCNTTTGCGTAAAGGGGTGGGGNNAGNNAAGNNNANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53971814..53972357 514
NO GENE  


Sequence tag IST14807G5HMR1
Sequence
NCTATGACATGAAACATGGTAGTGTGCCAGCAAACATGGTGCTGGAGAAGGAGCTGAGTGAACTGACTTGAGATTCTGAN
ACCCCAAAACCTACTCCTTAGTGATACACCTCTTCCTCCAAGACCACACCTCCCTATGAGCCTATGGGGCCATTTTTATT
CAAGCCACCACAGTTGGACAGTGTCAGGTATGAAATCATTGCTCTCAATGCTCAACGTTC
Sequence Type genomic DNA
Unitrap ID UNI11601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51956373..51956590 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019891 (Dcbld1) NM_025705 discoidin, CUB and LCCL domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913936]

 
Come back to gene ENSMUSG00000019891


For any suggestions or comments, please send an email to unitrap@crg.es