Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14528C5
Clone ID IST14528C5
Vector VICTR74
Project tigm

Sequence tag IST14528C5BBF1
Sequence
CACCAACAGCCAAAGTGTAACTGAACACAAATGAATACATGAAAATCTCTGTAAAGTTTGTTTATACAGTAATTTAAAAA
AAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116297813..116297903 91
NO GENE  


Sequence tag IST14528C5HMR1
Sequence
GGTGAAGTAATTACCAGCTTCCTTCCTGAATGGGTATTTACAGAAAATTACATGCCTACTTTTTGTTGTTGTTTTGAGAC
AGGGTTTCTCTGTATAGACCTGGCTGTCCTGGAACTCACTTTGTANACCAGGCTGGTGTCNAAACTCANAAATCCGCCTG
CCTCTGCCTCCCGAGTTCTGGGATTAAAGGTGTACTCCACCACACCCGGCTGGGTTTTTCTTTTATGTGTGTGTCTGTGA
GTGTATGCCATGTGAAGCTATTAGAGGATGTTGGATCTACTGGAGTTGGAGTTACTGGTTGTTATTANCCNCCATGTGGA
TGTTGGAAACTGAACCCACATGTGCTCTTTAACACCTTNNNCATCTTTCTAGCATANCAAATGCCTATACNNNCNTNTTG
CTGTTCAATTTGAATTTTATGTCNTGCCTGNCN
Sequence Type genomic DNA
Unitrap ID UNI16731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116297387..116297816 400
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]


Sequence tag IST14528C5HMF1
Sequence
CACCAACAGCCAAAGTGTAACTGAACACAAATGAATACATGAAAATCTCTGTAAAGTTTGTTTATACAGTAATTTAAAAA
AAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116297813..116297903 91
NO GENE  

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es