Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12592E7
Clone ID IST12592E7
Vector VICTR76
Project tigm

Sequence tag IST12592E7HMR1
Sequence
NCTGGAGGCTTGGAGATCCTTATCTGGATCTTGGTTTGAAGATCTTGAGCCNTAGTGGCTATGGATTCCAGAAGATTGAA
TCTCCGAGTTAAGGAACACACCTTTAATCTGGGCTATGCCTTTCATCTGGGATTAAAGGTGTGGTGGAACACACCTTTAA
TCTGGGCTACACCTTTTGCTGGAGACAATATAAGGACATTGGAAGAAGGGAGTCTAGCTCTAGCTCTTGCTCTTGCTCCT
TCGCCTGCTTGCTGCGTGAGACTGAGTAACTGCTAGATCCTTGGACTTCCATTCACAGCTGCGACTGAACCATTGTTGGG
AATTGGGCTGCCGACTGTAAGTCATCAATAAATTCCTTTACTATTTAGAAATTATCCATAANTTCTGTGACTCTAGAGAA
CCCTGACTAATACAGAAGTTGGTACCAGGANTGGTTCTAGAGTAACAGAANTACAAGGATGAATCTTTTAAAATTCTGGA
ATTGGCTNGNTGATCCACCANCNCNTTTCAACTATTGAAACCTCTCN
Sequence Type genomic DNA
Unitrap ID UNI2131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84966023..84966546 505
 
EST/CDNA Est Name
  CN686268.1 - BB621855.1 - CF167930.1 - CF165343.1 - CJ067845.1 - BY012911.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44028220..44028743 505
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034342 (Cbl) NM_007619 Casitas B-lineage lymphoma Gene [Source:MGI Symbol;Acc:MGI:88279]


Sequence tag IST12592E7HMF1
Sequence
CAGATAAGGGTCACTGGTGAGCCTTCCAATTCCGAATTGTAGTTCATTCCAAATATTGTCAAGTTA
Sequence Type genomic DNA
Unitrap ID UNI30946 UNI31095

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 53993090..53993154 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36657680..36657744 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31819255..31819319 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16878944..16879008 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62186158..62186222 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45777762..45777826 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22295830..22295894 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14224171..14224235 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14976519..14976583 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 104432786..104432850 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 45000191..45000255 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 85821349..85821413 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 70518266..70518330 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 69759941..69760005 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 39594909..39594973 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35325278..35325342 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3270024..3270088 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 19960599..19960663 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 90726708..90726772 65
NO GENE  


Sequence tag IST12592E7BBF1
Sequence
CAGATAAGGGTCACTGGTGAGCCTTCCAATTCCGAATTGTAGTTCATTCCAAATATTGTCAAGTTGACAACCAGGAATAG
CCACTACAGTTAGTTTTTTTGGTTTTATGTAANATGTATTTACTTATTTTATGTATATGAGTACACTGTAAATGTACAGA
AGGTTGCGAGCCATCATGTGGTTGCTGGGAATTGAATTTTAGGACCTCTGCTCACTCCGGCCCAAANATTTTATTATAAA
TAAGTACACTGTANCTGTCTTCAGAAGCACCAGGAGCCATCATGTGTTTGCTGAGAATTGAACTCAGGACCTCCANAAGA
NAAGTCNGTGCTCTTAACCNACCGCTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84965678..84966025 334
NO GENE  

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es