Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0145
Clone ID AD0145
Vector pGT0lxr
Project sanger

Sequence tag AD0145
Sequence
CCCCTACAGTTTTCGTCCCAGCCCACGGAACAAGCCGCAAGAGGAAAGGCTATTGGTGGAGAGCGCAGCCAATGGGCGAG
CCTGTTACTAGCCTGCGCCGTGTGCGGCGTAGGAGCGGCGCTTGAGGCCTGGAAGCGTTCCGCGGCCTGCCGGGTCAGCA
CCATGAGCTCCATCGGCACTGGG
Sequence Type mRNA
Unitrap ID UNI443

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72075572..72075754 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060073 (Psma3) NM_011184 proteasome (prosome, macropain) subunit, alpha type 3 Gene [Source:MGI Symbol;Acc:MGI:104883]

 
Come back to gene ENSMUSG00000060073


For any suggestions or comments, please send an email to unitrap@crg.es