Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14294D11
Clone ID IST14294D11
Vector VICTR74
Project tigm

Sequence tag IST14294D11BBF1
Sequence
TTACNNCTGTGTCNTTACAGAGTTCTTTGATAAAGCAGAAGAAATGACTGANTTTTTTTAAAAAAATCACCATTCTGGGG
CTAGATATATCACTCAGTGGCTTTCTGTACAAACATGAGAGACCAAATTTGAATCCCCAGCACCTAANTAAAAAGTTGAA
TATGGTTATATGCGCCTGTAACCCTTTGCTGTTGGCATGAGAAGANATGAGAACCAGTGGGACTTGCCAACCAGCCTANC
CNAAGCCCANCNAGTTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57303782..57304039 238
 
EST/CDNA Est Name
  BB869396.1 - BY008177.1 - BE650631.1 - BY335121.1 - BY125501.1 - BY125269.1 - BB872991.1 - CJ132931.1 - AA013693.1 - BU504099.1 - BB871660.1 - BU848408.1 - BU847992.1


Sequence tag IST14294D11HMR1
Sequence
NATAGCACTGGCTGTTCTTCCNNANGANCTGGGTTCAATTCCCAGTATTCACATGGTGGTATTGCCCCGTGCCTACTTCC
CCCTTGGATAGCCAGGCCTATAGGGGTTCAGGATGCCATCGATGAGGGTAAAGAACACAGTTGGGGATCAGCTTCGGGGA
CCTGGTTTGGTTTATTGGGTGGGAAAGGGCATATCCNTGCCCCTGAN
Sequence Type genomic DNA
Unitrap ID UNI16024

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57303578..57303782 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040722 (Scamp5) NM_020270 secretory carrier membrane protein 5 Gene [Source:MGI Symbol;Acc:MGI:1928948]


Sequence tag IST14294D11HMF1
Sequence
TTACCACTGTGTCATTACAGAGTTCTTTGATAAAGCANAANAAATGACTGAATTTTTTTAAAAAAATCACCATTCTGGGG
CTAGATATATCACTCAGTGGCTTTCTGTACAAACATGAGAGACCAAATTTGAATCCCCAGCACCTAAATAAAAAGTTGAA
TATGGTTATATGCNCCTGTAACCCTTTGCTGTTGGCATGAGAANANATGANAACCANTGGGACTTGCCNACNNNCCTANC
CNAANCCCANCAAGTTCCAGGTAGGANACTGTGTCTNAAGGGAATACANTGGANAAGGCNANATCNNGGTGNCTGANATC
CTTNACTGGCCTNNGGGTNAACTNNCATNGGCACACNCNTTNACNNTCANNCNCACGGNTAAGGNNNCNCNCNCCAANGT
NACACACACNTACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040722


For any suggestions or comments, please send an email to unitrap@crg.es