Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0132
Clone ID AD0132
Vector pGT0lxr
Project sanger

Sequence tag AD0132
Sequence
CAGCGTGAGGGAGGGGCTTCCTGGTGGGATATCAGCTGAGGAGGAGGGTTAGCTGGGTGCTTTCTCTGCCTGTCTGAGCT
AGCAGGCTCCCGAGTCTTTGTTGGTAAATATCGATTTTGTTATAAAACAGCCATCATCCCTGATGAGTAAGGACCTTGCA
GATGCAGCCTTTTTAAGGGAGAGGAGCGCCCACACTCAATGATTGTGGATTCTGCTGTGGGATTAGAAGCCACGTCTGTT
GTGATCGGAAAACTCCAGGAATAGCGGCCGAGATGGATGAACAGGCTCTTTTAGGGTTAAATCCAAATGCCGATTCAGAC
TTTAGACAGAGG
Sequence Type mRNA
Unitrap ID UNI2941

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 121059914..121065883 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034667 (Xpot) NP_001074525 exportin, tRNA (nuclear export receptor for tRNAs) Gene [Source:MGI Symbol;Acc:MGI:1920442]

 
Come back to gene ENSMUSG00000034667


For any suggestions or comments, please send an email to unitrap@crg.es