Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14970H4
Clone ID IST14970H4
Vector VICTR76
Project tigm

Sequence tag IST14970H4HMR1
Sequence
GTTCCNTCTTATGAACTGCTACTCTGTGCTTCTGGGCAGTAATGTTTCCATTGTCTGATTCCGGACACACCACAGGAGCA
ATGGTGGGTCNNAGGTTAGCTTCACCGATTTCTTTCCACTTATAAGTGGTGTGATACTTANTTTCAAATGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66388690..66388841 144
NO GENE  


Sequence tag IST14970H4HMF1
Sequence
GAACTTGTTGTTGGTTCTACAGCAGCTTGTTGTGGGGACTGTCTTACCTCTGCTAATGATTTTGTAAAACTATTGAAGCT
CTCCAAGAGATTAGTAAGAAAGGGCCCTGTTTGTTTCCTCTACTGGGCCTTTGTTGTCTTGCTTTTTGGAGAAAGTCACA
TTATGTAACTCAGTATTACCTGGAGCCCACTGGGTAGCCCAAGCTGGCCTCAAATCTGTGGTCCTCCTGTCTCANCCTCC
TGAGTGAAGGATTATAANCATGTGTCAAAATATTTGNTTNANNANTCNTGTTTNANCTGGANANAA
Sequence Type genomic DNA
Unitrap ID UNI15887

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66388393..66388693 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054598 (9130230L23Rik) RIKEN cDNA 9130230L23 gene Gene [Source:MGI Symbol;Acc:MGI:3041166]

 
Come back to gene ENSMUSG00000054598


For any suggestions or comments, please send an email to unitrap@crg.es