Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14440G12
Clone ID IST14440G12
Vector VICTR74
Project tigm

Sequence tag IST14440G12HMF1
Sequence
TGGTAACTGAATGAGTGGAGAGGTAGAGAGATAAGCCTGGGAGTTGTTGAATGAACACTTTGGGGGGATGAATGCGTAGG
TTGTGTTGGGGGTAGATGTGAGAGAGATGAAGGACCACCCTGCCTGTGTTCTGACCCTGGCANATGCTCCNNCNGGANGT
ANCTCTTNNNTGNANCNCCNTN
Sequence Type genomic DNA
Unitrap ID UNI35495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119890285..119890451 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079118 (Spnb5) spectrin beta 5 Gene [Source:MGI Symbol;Acc:MGI:2685200]


Sequence tag IST14440G12HMR1
Sequence
NNNNTGTACTCCTCCATCTACCNANTNATCCNTGTTCATCCNCTTANCTTCNCCCATCCGCCCATTACCCACTTANGTTT
ACTGTTTTACAAAATGAANATATGCTCTCCACCCCTAGGGGTCTCACTACTTANCANGAAATANTCAATGGCNGGAAGCT
TGGGACAANGATGGGGANGTTCANGANGCATCATGTTNNACCCCAACACANCATGTAAAGATGGACTAANCTGANCAAGC
CTGTCTGCNTGCNNNGCACACNGAANCTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14440G12BBF1
Sequence
TGGTAACTGAATGAGTGGAGAGGTAGAGAGATAAGCCTGGGAGTTGTTGAATGAACACTTTGGGGGGATGAATGCGTAGG
TTGTGTTGGGGGTAGATGTGAGAGAGATGAAGGACCACCCTGCCTGTGTTCTGACCCTGGCAGATGCTCCAGCAGGAGGT
AGCTCTTTATTGGAGCTCCATGGAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI35495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119890262..119890451 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079118 (Spnb5) spectrin beta 5 Gene [Source:MGI Symbol;Acc:MGI:2685200]

 
Come back to gene ENSMUSG00000079118


For any suggestions or comments, please send an email to unitrap@crg.es