Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14884H10
Clone ID IST14884H10
Vector VICTR76
Project tigm

Sequence tag IST14884H10HMR1
Sequence
TGTGTAGATTGCTCAGACAAATCCTTTCTTAAAAAAATAAAAATAAAAAAATAAAAAGTTGCCAGGCAGTGGTGGCACAT
GCCTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCAGATTTCTGAGTTCGAGGCCAGCCTGGTACAGAGTGAGTTCCAGG
ACANCCNNGACTACNCGGGGAAACCTTGTCTCAAAAAACCAAAATAANTAANTAAAATAAATANNTANNTNNNTT
Sequence Type genomic DNA
Unitrap ID UNI19951

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40601549..40601771 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038446 (Cdc40) NP_082155 cell division cycle 40 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918963]

 
Come back to gene ENSMUSG00000038446


For any suggestions or comments, please send an email to unitrap@crg.es