Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14014A2
Clone ID IST14014A2
Vector VICTR74
Project tigm

Sequence tag IST14014A2HMF2
Sequence
TTATTACGGAAAATGGATATCCACAAAATAATACAAGGAGTTAATGCGGGAATAGCTAGCAGTGGTTATACAACATTGTA
CAAAGCCNCTTANCTTTAANCTTGGAAAAAGATTAAATTGATAATTATTTCTGTTTCCTATAATAACACCACCAAACGGT
AAATAAAACAAATGTANAGAAAGCAATAACTAAGTGGATGGGCAAAGTAAAGGGAATTCANAATGATTTCCAGANTTTCT
CTTTGGGAAGANGCCCTGTATGATTGTTTCACCAAACAAGAACTATAGCTANGTANNCCTGGGCATGAACTTGTTACNAA
AAANGCACACTAAACACTGGACAACNGGAAATCNGTCTAANTGGCTGGNTCCANTGCTNANNANAGGTATTCNNNTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14014A2BBF1
Sequence
CCACAAATAGCTGGGATGCACTTCTCGCAAACCCATGCTCTGCCCAGTTGAATCGCAGCAAGAAGGAAAGCATCACACAA
TCTTAGTTTAAAATCGATAGGTAACACAATCCCTGGGTGCANAAACTANCATCGTAATTTTCCCTAAGTTAGGTCCTGGT
GGATCT
Sequence Type genomic DNA
Unitrap ID UNI32263

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40222262..40222426 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040111 (Gramd1b) NM_172768 GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]

 
Come back to gene ENSMUSG00000040111


For any suggestions or comments, please send an email to unitrap@crg.es