Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14502H6
Clone ID IST14502H6
Vector VICTR74
Project tigm

Sequence tag IST14502H6BBF1
Sequence
TTTTGGTTTCGACGTAAAGGAGACCGCTTGTGGACCAGTGAATTACCTGCTCCTGTAGAGTCTCTGTTCAGGAAATANAC
CAAATAGAAGACGTATAAGATTTTATACCANANGANTCTCACATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108509780..108509906 117
NO GENE  


Sequence tag IST14502H6HMR1
Sequence
AAAAGACCTCAGCATCCTTGAACAAGCTGTCTTTACAGGATGGACATAAAGCCAAAAAACCAGCATGTAAATTTGAAGAG
GGTCAAGATGTCTTAGCTAGATGGTCANATGGCTTGTTTTATCTTGGAACTATCAAAAAGGCAAGTTACCTTAATAAATT
TCTGCTATACTTGCATTACTCATTTTAATAATTTTAAAATTTAACCTCC
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108509903..108510110 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


Sequence tag IST14502H6HMF1
Sequence
TTTTGGTTTCGACGTAAAGGAGACCGCTTGTGGACCNGTGAATTACCTGCTCCTGTAGAGTCTCTGTTCAGGAAATAGAC
CAAATAGAAGACGTATAAGATTTTATACCAGATAAATCTCACATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108509780..108509906 125
NO GENE  

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es