Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14645B11
Clone ID IST14645B11
Vector VICTR74
Project tigm

Sequence tag IST14645B11HMF2
Sequence
GAAATATAATTTAAAGAATGTCCCAAACCCATGTTATTCTCTGAAGTGTCCATTCAAGTCACAGATGCTACACCTACAAT
GTCTGTGGGTCTATCTGCAATGTGGCACCAGACAGAAGTCATTTCTCTTTCTAAGTTTTCAGCCCATTTTTCCAAGTGTT
ATGCTACCGTCTTCCTTCCTCGGGCAATACAAATGTCAAGTGGGGCAAGAACCACACTGATACTGCATTCACCACGGTTA
TCTCTTTACCCTGAGCATGTATTGAACAGACAAGCCACCTGTGGTGGAGACAGAAGCTTGCTGATTACAATGTGCCTACC
AAGANTCACAGGGCTGGAACCTANGCCTGGCTTCCCTCCTTCGAGTANAGTTAATTTGTAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50145191..50145573 377
NO GENE  


Sequence tag IST14645B11BBF1
Sequence
CTCCTTTCTGGGCAAGGAGAGCCTAGAGTCTGAATCAGGGTTGTCCTGCTCCACATGCCTATTGGAGGGTTCCTTTCCTC
CCCAAGCCTCCCAGGTATTGGCCTCCCAAGTCTATGCTAAGAGGCCAGATTCAGCAAATCTGGTCTCTGGGGATAGAAGC
TCTCTGGTGAATGGCTGTCAGTGTTGCTCTACAGAAGCAAAAAGAATGCCCAAGCCCACCCAGACCAAAAAAATTCCAGG
AAAAAAGTCATAACCTTTGGGAGGAGGACTGACCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181427550..181427828 279
 
EST/CDNA Est Name
  BY081683.1 - BY012352.1 - BY021023.1 - BY020775.1 - BY012578.1 - BY195321.1 - BY203800.1 - BY026190.1 - BY160710.1 - BY093037.1 - BY039034.1 - BY204301.1 - BY045836.1 - BY024454.1 - DT921727.1 - BY015781.1 - BY010185.1 - BY223725.1 - BY013835.1 - BY180308


Sequence tag IST14645B11HMR1
Sequence
NTCCTGTAGGGAGGTGGGGGTGGTGGTGGTGAACNGNNTN
Sequence Type genomic DNA
Unitrap ID UNI16635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50145572..50145604 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073207 (6330534C20Rik) NM_001034059 RIKEN cDNA 6330534C20 gene Gene [Source:MGI Symbol;Acc:MGI:3588225]

 
Come back to gene ENSMUSG00000073207


For any suggestions or comments, please send an email to unitrap@crg.es