Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12878A6
Clone ID IST12878A6
Vector VICTR76
Project tigm

Sequence tag IST12878A6HMF2
Sequence
AGAGCACCCGACTGCNCNTCCGAAGGTCCANANTTCAAATCCCAGCAACCACATGGTGGCTCACAACCNTCCGTAACAAG
ATCTGACTCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAATAAATAAATAAGTCTTTAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAANNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20516479..20516664 176
NO GENE  


Sequence tag IST12878A6BBF1
Sequence
AGNGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAG
ATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI12672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18030934..18031020 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55580632..55580718 85
NO GENE  

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es