Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14167D3
Clone ID IST14167D3
Vector VICTR74
Project tigm

Sequence tag IST14167D3BBF2
Sequence
GCACAACCCTCGCGAGGGCCCCAGTCTCCTCGGAACGCAGACTGCCTTTACAGATAACTGCCCTCCGCAACCCCGGAAGC
CGCTGTAACCCGCAACGCCGCCCCGATCCCGCCCGCCGGGAAGCCTCGGCCGGGTTATCCGAGCCTCAATACTTACCTCC
CGGAACGCCGCGCCGCCGCACCGGAAGTGATCCCTCGTGACCCGGAAGCGATGTGCTGGGAGCAGCAGCAGATTCCGCTC
AGCGGGTTTTACCAGGTCCACCGCTTCCTCGCCGTCTTCCTCCTGCTCTCCCCTAATTAGACACCGAAGGTTGAAGCTTT
AATGAATTTTTTATTTGATTTGAGACAGGGTCTCAACAGTGTANCTCTGACTGGCCTCGAACTGGGGGCAATTCTCCTGA
TTACAGCCGGTCTCCCCCCAGTTTAGAACTCAGTTCTAAGTCTGANCCNNNNNNCTACAATATAAGGGGTAGGACAAACA
TTACCATGCNATAATTNNNANNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157193037..157193532 478
 
EST/CDNA Est Name
  W80148.1


Sequence tag IST14167D3HMF1
Sequence
NCNNANNNCTCGCGAGGGCCCCAGTCNCNNCGGANNGCANANTGCCTTTACAGANAACTTTTCTGTANTCNGGAGCTTGG
GGAGANCCTATGGGTGCCNNNCTGGTNNANACTGTTNNATANACANGCNNNNAACANTCNNGCNTGTGCCCCATGGTCAT
GANNGGGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14167D3HMR1
Sequence
TGCAGGGCCNGGGCCCAGCCTGCCCTGCGCCGGGACCNGCCGGGGCTTGGCTTGTCGGGTGTGCCCTGGATGGCTGTGTT
ACCTCGGGCATCTCGATCTTCCTCTCCCGGTCACTTTCCTTCCCCGCAGAAGGCTCCCTTGGGCCTGTGCGGAGGATGCG
AAGGCCGGGAGCGTATCANTGCTTANTTGCNNTGTGTGCTTGANANAAAACTGCCAGAGAAAGGGATGGGGAATGCNATA
NCCTCCCCGGTGTCTGCGGTTCCN
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157193530..157193792 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es