Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13090B3
Clone ID IST13090B3
Vector VICTR76
Project tigm

Sequence tag IST13090B3HMF1
Sequence
ATCTTCAACCATAGGACTAGAGACAGCTCTACTCTTGTGCTCCGTTCACCCATCTGCCTACCACATACTTATACTTTGTA
GTGGCTCCCACTGCAGGAAGACCATGTTGCTGGTCTCTGGGTGTCTTCCTCTGCCCATGCCACTGGGGCCCCTCCCTGTT
CCTAAGCTAACCTGTGTACAATAAACCATTTCTGTAAATAAATGCTTTGAGTTTCACATATAAGAAAAACAGCCTAAAAT
CTGAAATTAGAGTTCTGAAAAAATTTAGACAAGGGAATAGAAAGGAAAGACTTTATGTATGTTAACGC
Sequence Type genomic DNA
Unitrap ID UNI4069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16104157..16104463 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]

 
Come back to gene ENSMUSG00000041974


For any suggestions or comments, please send an email to unitrap@crg.es