Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12781E5
Clone ID IST12781E5
Vector VICTR76
Project tigm

Sequence tag IST12781E5BBF1
Sequence
NATTAGAAGAAAAAGAGGAAAAAGGGAGAAGAAAAAAGATCAATTAGCGGAGGTCTCTAGGAGAAGGAGCCTGTGCTCTG
AANAAACNGACTGGGANAAAANAGCGGCN
Sequence Type genomic DNA
Unitrap ID UNI34590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 112226537..112226643 99
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74354550..74354656 99
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 87492732..87492838 99
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 50217093..50217199 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039316 (Rftn1) NM_181397 raftlin lipid raft linker 1 Gene [Source:MGI (curated);Acc:Rftn1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 158893065..158893171 99
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 52904170..52904276 99
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 106157372..106157478 99
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 115573682..115573788 99
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 95302198..95302304 99
NO GENE  


Sequence tag IST12781E5HMF1
Sequence
AGATTANAAGAAAAAGAGGAAAAAGGGAGAAGAAAAAAGATCAATTAGCGGAGGTCTCTAGGAGAAGGAGCCTGTGCTCT
GAAAAAACAGACTGGGANAAAAAAGCGGCTCATTATGAAAGAAAAGGATACCAGCCGCCAAGTAAAGTGCTAACTAGTCA
TTTAAGGAAAAAGCCAAAAGCGGCTGGCGAAGGCCAGTTTGCTAATTGGCCTCAGGGCAATCGGCTACCAGGTGCACTCC
CGCCCTATGCGGAGTCCCCGCCCTGCGTAGTGCGTCAGCCCGTAGTGCGTCAGCAATGCGCANAGAGGCAGTGCGCAGAC
TCATTCATTCCCCGAGANGAACAAAGGNAAATNNAACAGGCATTTCCAGTCTTTGAANGAGCCGANGGTGGGCNTGTCCN
CGCTCCGGTAGAATACNTACAGATTANNNAAATTGCCGANTCNNTTCGTAAATACNGANCCNNTGCTNATTTTACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039316


For any suggestions or comments, please send an email to unitrap@crg.es