Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST472521
Clone ID OST472521
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST472521
Sequence
GACTGAGGAGTCTCCTCAATAAATTNAAGGAGTGAGATGACCCCAGAGGAGCTGCAGAAGCGGGAGGAGGTTNAATTCAA
CACAGGTCCCCTCTCAGTGCTCACGCAGTCGGTCAAGAACAACACGCAAGTGCTCATTAACTGTCGCAACAACAAGAAGC
TGCTGGGCCGGGTGAAGGCCTTTGACAGGCACTGCAACATGGTGCCTGGAAAATGTGAAGGAGATGTGGACTGAGGTTCC
CAAGAGCGGCAAGGGCAAGAAGAAATCCAAGCCTGTCAACAAGGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACT
CGGTCATCGTGGTGCTGCGGAACCCACTCATCGCTGGCAAGTAGAGCCTGCTCCCTGCCCTGCGAAGGCCTGCAGAACCC
TGCCCAGTGGGCAAGAAATAAAACCCTGTGCTTTTTGGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI11542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19736565..19738075 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040824 (Snrpd2) NM_026943 small nuclear ribonucleoprotein D2 Gene [Source:MGI (curated);Acc:Snrpd2-001]

 
Come back to gene ENSMUSG00000040824


For any suggestions or comments, please send an email to unitrap@crg.es