Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST472465
Clone ID OST472465
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST472465
Sequence
GCGTGGCTGAAAGGATGCTCATGTTTGATCCAGTCCCTGTCAAGCAGGAGGCCATGGACCCTGTCTCGGTGACCT
Sequence Type mRNA
Unitrap ID UNI770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65207999..65208069 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es