Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13061F12
Clone ID IST13061F12
Vector VICTR76
Project tigm

Sequence tag IST13061F12HMR1
Sequence
TGGCGAGTGTCGGAATTAGTGAAAATTGTACCGAGATGTATGAGTGTCTTGTTATTATGACTACCCTATCCTTACTATTA
TTTTAAATCAAAAGTATTCTGATTTTTGCTAGTGCCAAAAGTAATGGGCTGTAGTGATTTATTTGCTAAATTTTACTTGA
TTTTTTTTTAATGCTGCAAATAATATGTACTTACTTGTACATGTAACTTACGTGGGGCGTGTTTCATTTAAAGAAATTTG
ATGTTTAATTANCTTTGCTCTTATATTTCATTTTGTGGGTATCTAAGGATACTTCAGTTAATTCAGGTAGTTTTGTTTAN
NTGTATATAGATTTGGATACACANNNANACACACACACACACACNCGCGCNCGCGCNCNCN
Sequence Type genomic DNA
Unitrap ID UNI510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114822255..114822630 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]


Sequence tag IST13061F12HMF1
Sequence
GCCNAAGGGAAAAGCTTCCTTTTCTACACTGTTCACCTANATGTGCTGTTTACCCANGGTGCACCTTAGGGGTGCGCCTT
TTCCCTTTAAATCACTGCTGAATGACAAGAGTCTCTTAAAGCTGTCANAGGATTAAAATGGCNNGTGGGTACAAGGGATG
GGACAGAGGTCTCTGTCTCCNNGCTAATAAAAACCTAGTCNTAAGCCAGGCATGGTGGTATACGGCTTTAATTCTTGCAC
TGGGGNAGGCAGNNNNNNNCGGCCTTCTTTGAGTTCCAGGTNTACATAGTGAGTTCTAAGACAGCNAGAGCTACATAGTG
AGACCCTGTCTCACAAACAAAGAAAACAAAACATAAACCACCAACAACAACAACAACNAAACCCCAAATAAACAGATNAA
TGCCTCAAAAACAAAAACCTAATGATTTCAGAATAAATTGTATTTATTATAATTTTTAAAACANCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042348


For any suggestions or comments, please send an email to unitrap@crg.es