Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12332G4
Clone ID IST12332G4
Vector VICTR76
Project tigm

Sequence tag IST12332G4BBF1
Sequence
TACAAAAGTCTTGCAGGTGGAATTAAACTGTTCCAGTGAACTTAAGTTCCTTTTCTACTCTCTTAACCATAGGTCTTTCT
GTGCAGTCTGCTTTGCTGAAAGTGGAAAGTCCCTGTTTGTGGACAGCTCAGTTCTCTCCCGCAGAGGAAATGGGCAGAGT
CCTACTCCTCCCGTATGCAAAGTGGGGGAGGGGAGCCATGCACTCCTCGGTGCGCTTTTTGAATGGACCTGAATTTTTCA
CTCTAGAAAGATTAGGAGCTGAGACCAGAACCTTTTCCCATGTGGCACCACACCCAGCCTCTTCACCCCCACACAGTATG
GTGCTAGCTTGAGGCTCTAGAATAGGGTGCCATAGCAACTTGAAGTAAATAAAATGACTGAAAATGAGATCGTTTGGGGG
AAGGTGTGAGGCATCTGGAGTTTTGGTAAAAGGGGATCTTAATAGAGGACNNNTTNNNANNGTANNNANGTTTTGTGAGC
CCTAANTCTGGAATTTAGAGCATANNCNGTAAGTNNANGATAAAAGTNNTTAAAAGTTCTGATTCNNNCTNNNTCAAAGA
NTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12332G4HMF1
Sequence
TACNAAAGTCTTGCAGGGGGAATTAAACTGTTCCAGTGAACTTAAGTTCCTTTTCTACTN
Sequence Type genomic DNA
Unitrap ID UNI13020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4332979..4333037 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054611 (Fbxl11) NM_001001984 F-box and leucine-rich repeat protein 11 Gene [Source:MGI Symbol;Acc:MGI:1354736]

 
Come back to gene ENSMUSG00000054611


For any suggestions or comments, please send an email to unitrap@crg.es