Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST472416
Clone ID OST472416
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST472416
Sequence
GACTGAGGCCTCTACTGCCTTGTAACCTTGGTCTTCTTCTATTCCTCTGCCTCATTCTGGGCCTGGATGGCCCTGGGCTT
TAGCTTGGCCGTGTACGGGGCCAGCTACCACTCTATGAGCTCGATGGCTCGGGCATCCTTCTCTGAGGATGGGTCCTTGA
TGGATGGTGGCATGGACCTCAACATGGAGCAGGGCATGGCAGAGCACCTTAAGGATGTGATCCTACTGACAGCCATTGTT
CAGGTGCTCAGCTGTTTCTCCCTCTACATCTGGTCCTTCTGGCTTCTGGCTCCAGGCCGGGCCCTTTACCTTTTGTGGGT
AAACGTGCTGGGCCCCTGGTTCACAGCAGACAGTGGAGCCCCTGCACCAGAGCTCAATGAGAAACGACAACGCCGACAGG
AGCGGCGGCAGATGAAAAGGTTATAGCATCCTTAACTGAGGCTGTAGGCTGCTGGGCACTGGTTGGCTCTGTTATGCTGC
GTGGCCCCATGCCTGA
Sequence Type mRNA
Unitrap ID UNI15823

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107852068..107852878 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014856 (Tmem208) NM_025486 transmembrane protein 208 Gene [Source:MGI (curated);Acc:Tmem208-003]

 
Come back to gene ENSMUSG00000014856


For any suggestions or comments, please send an email to unitrap@crg.es