Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST472409
Clone ID OST472409
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST472409
Sequence
GACTGAGGTAAATGGAAATAATCAACAAGGGCAAACTTCTAAAGTAAAATCGGAAGAGAAGTCTTCGTCAATTTGGGAAA
ACAGTCCTTCACGTCTTGGAATCTAGTCAAGAGTCAGTGCTGAAGAAAAGGAGAGTTAGTGAACCAAAGGAACATACCTA
AAAATTATTTTTCTTATGCAAATTTGCAGTTCTCAACATTTAAACTAATATGCTGTATTATTTGAAGGTGTGCCTTCTGT
ACCTCTGAAAATTATTTTGTAGTTCATAGTTATTAAACTAATAAAAGTTTTAGCTATTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI15824

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95389060..95391518 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028109 (Hormad1) NM_026489 HORMA domain containing 1 Gene [Source:MGI (curated);Acc:Hormad1-002]

 
Come back to gene ENSMUSG00000028109


For any suggestions or comments, please send an email to unitrap@crg.es