Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0090
Clone ID AD0090
Vector pGT0lxr
Project sanger

Sequence tag AD0090
Sequence
TACAGAAGATCCTGTGAAGACTCCTCGGAGCTTTTGGATAGTGATGCTCTCAACAGGCCCCTCAACATCATGATCCCTAA
ATTCCTGCAGTTTTCNAAGCACTGCAGCCTTAAGATCCGGTCCCACGCCATCGCCTGTGTGAACCAGTTCATCATGGACC
GGGCCCAAGCGTTGATGGACAACATTGACACTTTCATTGAGCACCTGTTTGCCTTGGCTGTGGATGATGACCCTGAGGTG
AGAAAGAACGTGTGCCGGGCCCTTGTGATGCTTTTGGAAGTACGAATTGACAGGCTCATCCCTCACATGCACAGCATCAT
CCAGTACATGCTGCAGAGGACCCAGGACCATGATGAGAACGTGGCCCTGGAGGCCTGTGAGTTCTGGCTGACGCTAGCCG
AGCAGCCCATCTGCAAGGAAGTCCTGGCCTCTCATCTGGTCCAGTTGATCCCTATCCTCGCGAAAAGGGTGAAGTACTCT
GAAATTGCACATCATCCTTC
Sequence Type mRNA
Unitrap ID UNI2945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87568517..87571075 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031691 (Tnpo2) NM_145390 transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]

 
Come back to gene ENSMUSG00000031691


For any suggestions or comments, please send an email to unitrap@crg.es