Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12502A10
Clone ID IST12502A10
Vector VICTR76
Project tigm

Sequence tag IST12502A10HMF1
Sequence
CTATGACTGGGTGTTATGGTCTGGAATCAACAGTTTTGGTGGCAACCACTTGTATCCCAGCGCGGGAAGATAGACGTTAA
GTTTGAGGCCAGCTTGTGTTACATAAGTCCCAGGCCAGCCNGANCCACTCAATGAGAGCCTATCTTTAATCAAAGCCAGA
AACAGGTTAAAACCNNTCCTANTAATAAACCTTTGAAATCTCCACTANTANGTGAACTATGGGGTGTGCATGGNNAGATA
CNTGANNCNNNCTACNTGGNNNANTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12502A10BBF1
Sequence
GAAGAATCATATGTCTGAAAATCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTC
TTTCTTTCTTTCTTTCTTTCTC
Sequence Type genomic DNA
Unitrap ID UNI12046

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17416312..17656194 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038843 (Gcnt1) NM_010265 glucosaminyl (N-acetyl) transferase 1, core 2 Gene [Source:MGI Symbol;Acc:MGI:95676]

 
Come back to gene ENSMUSG00000038843


For any suggestions or comments, please send an email to unitrap@crg.es