Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13011E3
Clone ID IST13011E3
Vector VICTR76
Project tigm

Sequence tag IST13011E3HMR1
Sequence
AAAGGCTTGTCTTTACATTAAAAGAGTCTAAGTCNGATGGTTCCTTTAATGCACTACCTAAAAGAAAATTTGGTATATTT
CCATGAGTAATGACTAAAGATTAGCTGTGAATGTTGAAAGCATATTCTCCTAGGTAGCTCATTGTTGCCATGACAGTGCT
GGCACTGTGAGTGTTGTANTAACTCCTTGCAGTGATCTTATTTTANACCCTAATGTTCCTAAGTGCTAAAAGTCCCCTTC
CCGCCCCACAAGAACCTCTAGTGGAAAAGTACTGGTTTATAG
Sequence Type genomic DNA
Unitrap ID UNI31488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41542411..41542692 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038332 (Sesn1) NM_001013370 sestrin 1 Gene [Source:MGI (curated);Acc:Sesn1-001]


Sequence tag IST13011E3HMF1
Sequence
TTTCTATACACCGGATTTCTAGCATCCCCACTGCAGGCAGTCGGTATAATTTACAGTGATGGTGANGAAGGCTATAGACC
ACAGTGAAACATCAATACTCACCAGGGTTCAAATACAGTTCCAGGATGAGTCAGGGTTTAAGTAAAATTTTGATTTTATG
TTTTAAGGCNNAATAATTTAGTGATATATACTGACTGCTAATATCTTATTAAATCTTTATTCAGATAATGTTGTATAATG
GTGACAAGTCTCATGGCCCACTGTGAAATCTAGCTTCTCCTTAACTTATGATGTCTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41542115..41542413 293
NO GENE  

 
Come back to gene ENSMUSG00000038332


For any suggestions or comments, please send an email to unitrap@crg.es