Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12696A11
Clone ID IST12696A11
Vector VICTR76
Project tigm

Sequence tag IST12696A11BBF1
Sequence
ATAGAAAACACAGTCATTCAACTTGTTTCCTACAGACCGTAAATCATGGACTTTAGGAGCCTTCTTTGAGTCTTTGAGCT
GCCATGGGTACTTTACTTTGGGATATANGTGCCTCCCTGCTTNANNGANNTNANNGN
Sequence Type genomic DNA
Unitrap ID UNI33060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 146137952..146138073 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028188 (Spata1) NM_027617 spermatogenesis associated 1 Gene [Source:MGI (curated);Acc:Spata1-001]


Sequence tag IST12696A11HMF1
Sequence
ATAGAAAACACAGTCNTTCAACTTGTTTCCTACAGACCGTAAATCATGGACTTTANGAGCCTTCTTTGNNTCNTTNANCT
GCCNNGGGTACTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028188


For any suggestions or comments, please send an email to unitrap@crg.es