Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14728B10
Clone ID IST14728B10
Vector VICTR76
Project tigm

Sequence tag IST14728B10BBF1
Sequence
CGGCTAAAGGTAGCACTCGTTCAAACGCGGTCTTCACACATCTCCACACAATCCTACCCGCCTAACTTCCACCCACAGAG
TTTTTCATTAATGCATTCATTCATTATCTCAGCCATCACATGTGCACCCACGTTCGTAAAGGCACATAAAGGATAACGAG
CAAATTATAGTCACATCACGGCTGCTGCAAACCGCAGGCATCCCGTCCTCTACCCACACCCGCGACCGCTCTACAGGGCC
CTGGCTTCCACCCAGCACAAAGAGTCCTGGCCTCCAGCTCACGGCTTCCGGGACTCAACGCTGAGCCGGGCCACGGGTCT
CGATCCCCCAACCCGACGCCGCCCAAGGCTCACAGCCTCCGGGCTACGGCCTGGTGCTGCTAGGCTGGGAAAGAAGANCC
ACAAACCTGGGTCCGCTAGGCGCANGGTAGCACTTCCCAGANGGCCGCGCGNNTCGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30738468..30738923 446
 
EST/CDNA Est Name
  BB621686.1 - BE534724.1 - BY165308.1 - BY159855.1 - BY308145.1 - BY170150.1 - BY163939.1 - BB651143.1


Sequence tag IST14728B10HMR1
Sequence
GCCGTTTATAATAATTGAAAATATTTTTATATGAAGCATCAGTATCTCCAGGACTTGACTATTTTCCTGTATTGACAAAC
TGTCTTGTGTACATGACAGGCGAAATTCATTTGCCTTGCAGCCCAACTCCATTTCCCAAATAGCAAGATACAGAAAAGCC
CAAAGACTAAAAATTATTTATTTCTCCTAGTCAGTCATGCAGCTCCTGACAAATTGACTTCTTTACACTCGTGAGCATGA
ACGCGTACATTTATGTGCTCATATAAAGAGCATGGCCTCTTAAAAGAGCANTAACGGGCTGGAGAAATGGCTCAGTGGTT
AAGAGCACCGGCTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCATAACCATCTCTAATAGG
ATCTGATGCCCTCTTCTGGTGTGTCTGAAGATGGCTACAGTGTACTCACATAAAATAAACAAATCTAAAAAAAAGAAAAA
AAAAGAGCANTANCATCATATNTACNGTTCTGTAACTTACGGCTCTTATTTANCCNTTGNTGTNGNTN
Sequence Type genomic DNA
Unitrap ID UNI32608

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30737929..30738471 527
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]


Sequence tag IST14728B10HMF1
Sequence
CGGCTAAAGGTAGCACTCGTTCAAACGCGGTCTTCACACATCTCCACACAATCCTACCCGCCTAACTTCCACCCACAGAG
TTTTTCATTAATGCATTCATTCATTATCTCAGCCATCACATGTGCACCCACGTTCGTAAAGGCACATAAAGGATAACGAG
CAAATTATAGTCACATCACGGCTGCTGCAAACCGCAGGCATCCCGTCCTCTACCCACACCCGCGACCGCTCTACAGGGCC
CTGGCTTCCACCCAGCACAAAGAGTCCTGGCCTCCAGCTCACGGCTTCCGGGACTCAACGCTGANCCGGGCCACGGGTCT
CGATCCCCCAACCCGACGCCGCCCAAGGCTCACAGCCTCCGGGCTACGGCCTGGTGCTGCTAGGCTGGGAAAGAAGANCC
ACAAACCTGGGTCCGCTAGGCGCANGGTANCACTTCCCAGANGGCCGCGCGGNTCGCCGGCNGGGGTCTGGCCTTCGGCG
TGCNAGTCAGGAGAGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30738468..30738963 475
 
EST/CDNA Est Name
  BB621686.1 - BE534724.1 - BY165308.1 - BY159855.1 - BY308145.1 - BY170150.1 - BY163939.1 - BB651143.1

 
Come back to gene BB621686.1 - BE534724.1 - BY165308.1 - BY159855.1 - BY308145.1 - BY170150.1 - BY163939.1 - BB651143.1


For any suggestions or comments, please send an email to unitrap@crg.es