Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14633C8
Clone ID IST14633C8
Vector VICTR74
Project tigm

Sequence tag IST14633C8BBF2
Sequence
GGCTGGTGAGATGGCTCAGTGGGTTAGAGCACCCGACTGCTCTTCCGAAGGTGCAGAGTTCAGGTCCCAGCAACCACATG
GTGGCTCACAACCATCCGTAACAAGATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI2503 UNI9274 UNI31285 UNI31286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 36961806..36961915 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98833823..98833932 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55808961..55809070 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52753338..52753447 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78416235..78416344 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049624 (Slc17a5) NM_172773 solute carrier family 17 (anion/sugar transporter), member 5 Gene [Source:MGI (curated);Acc:Slc17a5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 55943437..55943546 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078446 (AC153521.7)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148307801..148307910 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33698189..33698298 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079562 (Maea) NM_021500 macrophage erythroblast attacher Gene [Source:MGI Symbol;Acc:MGI:1891748]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 86449395..86449504 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038024 (Dennd4c) NP_001074483 DENN/MADD domain containing 4C Gene [Source:MGI (curated);Acc:Dennd4c-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 55003078..55003187 106
NO GENE  


Sequence tag IST14633C8HMR1
Sequence
NNNNACTCAGGAGACAGAGGCAGGCAAATCTCTGTGAGTTTGAAGCCNGCCTGGTCTGCANAACAAGTTCTAAGACAGCA
GGGGCTACAAGGAGAACCCCTGTTTTTGTTAAGGGGGAGGGTCAACGGGTTCTNNNNTNCTANGGTGCTTATGCAGCAGT
CACGGGGCCCTGGGCTTGCTCCCAAGCATTAAAAGGACAGAANACTAGGTGAGGGCTCGGTGAGTGGGGAATGAGGGCAN
CTGGGAAGAGGAAGGTGCGCANTGCAAGGCCAGGGGCTGANACAGCNNCTTCCNTGGNAACCGGGTGGAACACATGANGT
GACTGTCCTCNNNCCCTGCCCANCTCTGGATTTCCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038024


For any suggestions or comments, please send an email to unitrap@crg.es