Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12315G6
Clone ID IST12315G6
Vector VICTR76
Project tigm

Sequence tag IST12315G6BBF1
Sequence
GTATGGTGTGTACCTGTAGTCCCAACATTTANAAGACTAAGAAGGAAGAATTCCCAGAGCCCAGAAGCCAGGGAGATGTA
GTCTTTACACAGCCTGGAGAAAGTGGGTCACAGCTATGGTTGAAAGGCAGAAATTAGCCCCTCTGTTTGGAAAAGGAGAA
ACTAAGGAAAGATCAGAAAACTGATGGGCCTTCCTTTGCTGATAACCAGTAAACTTTCCAAGTCCAATAACACTGGCTAG
ACCACTCTAAGGTAAATGCATTCAGAACTCTGGATTCCCAGGACATTTGTCACCATAGTGAAGGGCAGGAGACAGTAGGT
AAACAAGCCTGGTCACACGTCTTCTGAGTGGTAGGTGGAGAAGTGATCTCACCATTTGCTCAGGACCAGGCAGGCTCTTG
GGTTCATCTAGGGGGGGCTAAGACGGGATGGGTCANCCNGGGAGCTAGATGCAAGANCTCTGTGGGCTGANGGATCATGT
CTTTATTCCNCAGANACTCCAAACACCCCAAGTACTGCATCN
Sequence Type genomic DNA
Unitrap ID UNI30563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4897667..4898187 507
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006464 (Bbs1) NM_001033128 Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]


Sequence tag IST12315G6HMF1
Sequence
GTATGGTGTGTACCTGTAGTCCCAACATTTAGAAGACTAAGAAGGAAGAATTCCCAGAGCCCAGAAGCCAGGGAGATGTA
GTCTTTACACAGCCTGGAGAAAGTGGGTCACAGCTATGGTTGAAAGGCAGAAATTAGCCCCTCTGTTTGGAAAAGGAGAA
ACTAAGGAAAGATCAGAAAACTGATGGGCCTTCCTTTGCTGATAACCAGTAAACTTTCCAAGTCCAATAACACTGGCTAG
ACCACTCTAAGGTAAATGCATTCAGAACTCTGGATTCCCAGGACATTTGTCACCATAGTGAAGGGCAGGAGACAGTAGGT
AAACAAGCCTGGTCACACGTCTTCTGAGTGGTAGGTGGAGAAGTGATCTCACCATTTGCTCAGGACCAGGCAGGCTCTTG
GGTTCATCTAGGGGGGGCNAANANGGGATGGGTCANCCNNGGANCTNGNTNCNAGANCTCTGTGGGCTGANGGATCATGT
CTTTATTCCNCAGANACTCCNAACNCCCCAAGTNCTGCATCNAGTTGAGTGCCCAGCN
Sequence Type genomic DNA
Unitrap ID UNI30563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4897651..4898187 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006464 (Bbs1) NM_001033128 Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]

 
Come back to gene ENSMUSG00000006464


For any suggestions or comments, please send an email to unitrap@crg.es