Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10090E1
Clone ID IST10090E1
Vector VICTR75
Project tigm

Sequence tag IST10090E1BBF1
Sequence
GCTCGGATACTGCAAGCAGCCCTCCACCTCCCATCGCCTCACTAGCTGTCCTAGACAGGGTTTGTATTCCTGCACAAACA
TCATGACCAAGAAGCAAGTTGGGGAGGAAAGGGTTTATTCAGCTGACACTTCCACGTTGCTGTTCATCACCAAAGGAAGT
CAGGACTGGAACTCAAGCAGGGCAGGAAGCAGGAGCTGACGCTTGTTTCCCCTGACTTGCTCAGCTTGCTTTACTTTCTT
TTTTTTAAAGACTGTTGTGCTGGGCAGTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTT
CTGAGTTTGAGGCCAGCCTGGTCTACAAAGTAAGTGCCAGGACAGCCAGAGCTACACAGAGAAACCCTGTCTCGAAAAAA
AAAAAAAAAAAAAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119523102..119523515 414
NO GENE  


Sequence tag IST10090E1HMF1
Sequence
NCTCGGATACTGCAAGCAGCCCTCCACCTCCCATCGCCTNACTANCTGTCCTANACAGGGTTTGTATTCCTGCACAAACA
TCATGACCNAGAAGCAAGTTGGGGAGGAAAGGGTTTATTCANCTGACACTTCCACGTTGCTGTTCATCACCAAAGGAAGT
CAGGACTGGAACTCAAGCAGGGCAGGAAGCAGGAGCTGACGCTTGTTTCCCCTGACTTGCTCANCTTGCTTTACTTTCTT
TTTTTNAAAGACTGTTGTGCTGGGCANTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTT
CTGANTTTGAGGCNNNNCTGGTCTACAAAGTAAGTGCNNGGACAGCCNNANCTNCACAGANAAACCCTGTCTCGAAAAAA
AAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10090E1BBR1
Sequence
GAGCAAGTCGCCCGTAGGACTAGTTGCCATCCTGTGACTGTCATGCATGTGACCATGTAGTAGGCTACAGACTAGTGTTA
CATGCCAGGTCTTAGCAGTCAGAGAACCAAGATTTCATTAAGACCCCGGCTTCGTTCCCCCAGGCTCACTCTGCCTGCTG
GGATGCTTTGAGTCTCTGTCTTCCTGAGAGGAGCTGATAGTGCCACCTTCCTTATGACTCAGGGGCACTGACTGGGACCC
TGGGATCAGCTCCATGCAGAGACCTGGACAGGGGCTTTTTTTGTCATGTCTCAACACCCTAAAACTTCTACTTTGTTATG
CTATAATTAATACTAGGTAATTAGTAAACAACGGAAATTTACAGTTCCTAGTTCTGTAGATTGTAAAACTCAAGGTCCAC
ATGTAGCAGATGGTGTGTCTCGTTTCTGCTTCCAGGCTGTTGCCTTGAACATCCTCACCTGGTAGGACAGGGCAAAGGGG
CTAGCTAGTTGTTTCCAGCTCCAACTCCCCCACCCTTTAATTAATACCCCTCCCCCCCATTTTCTTGGTGTAGTTCTGTC
TGTCCTGGAACTTGCTCTGTAGA
Sequence Type genomic DNA
Unitrap ID UNI19723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119523512..119524093 579
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025583 (4932417H02Rik) NM_028898 RIKEN cDNA 4932417H02 gene Gene [Source:MGI Symbol;Acc:MGI:1921620]

 
Come back to gene ENSMUSG00000025583


For any suggestions or comments, please send an email to unitrap@crg.es