Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12065G10
Clone ID IST12065G10
Vector VICTR76
Project tigm

Sequence tag IST12065G10BBF1
Sequence
AGATGAGTCGTAAAGAAACATCTAGGACAGGGATTCACGCCGTGGTAGGGGACGCAGAGTAGACCCACGCCACCAGCAAG
CCACACAGAGCAGAAAGCCCGACCTGCCAAGCCAGGCGCTGGGCTCACAGTCCTACCACGTGTTGTAGTACCATCTGCGC
CTGCGCTAGTGAGGCGCGCGCCCGGCGGCCGGAAGAGCCGCGCGTTTCCGGGTTGGAGGCGGGGAGCGGTGCCGGAAGTG
CTTGGGGAGGGCCGCGCAGTCGGACCGGCTGCTGANACGAAAGCTTCACTGGGGCAGTCTCCGCATATCATGGGGAGATA
GACGCTGCTGCCTGTGAGTCTTGGGCCCTGGCAGTTGANGACGAAGANCGGGAGGAGGGTGTCAGGACCCANANCCACAG
CGGGTCANTGCTGGAAGAACTAGGCTGTGGAANAGACNGGGCTGN
Sequence Type genomic DNA
Unitrap ID UNI10755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131830070..131830513 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028899 (Taf12) NM_025579 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf12-001]


Sequence tag IST12065G10HMF1
Sequence
AGATGAGTCGTAAAGAAACATCTAGGACAGGGATTCACGCCGTGGTAGGGGACGCAGAGTAGACCCACGCCACCAGCAAG
CCACACAGAGCAGAAAGCCCGACCTGCCAAGCCAGGCGCTGGGCTCACAGTCCTACCACGTGTTGTAGTACCATCTGCGC
CTGCGCTAGTGAGGCGCGCGCCCGGCGGCCGGAAGAGCCGCGCGTTTCCGGGTTGGAGGCGGGGAGCGGTGCCGGAAGTG
CTTGGGGAGGGCCGCGCAGTCGGACCGGCTGCTGAGACGAAAGCTTCACTGGGGCAGTCTCCGCATATCATGGGGAGATA
GACGCTGCTGCCTGTGAGTCTTGGGCCCTGGCAGTTGANGACGANGAGCGGGAGGAGGGTGTCAGGACCCAGACCCACAG
CGGGTCAGTGCTGGAAGAACTAGGCTGTGGAAGAGANNGGGCTGANGAGCCCANGCTCTTGGGACGGGACTTGANGGGTT
CGGGCTCGCAGAANCAGCGGCTGTTGGGGACTCGAGCTNTGAANGANAGANTN
Sequence Type genomic DNA
Unitrap ID UNI10755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131830070..131830599 508
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028899 (Taf12) NM_025579 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf12-001]

 
Come back to gene ENSMUSG00000028899


For any suggestions or comments, please send an email to unitrap@crg.es