Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14249H1
Clone ID IST14249H1
Vector VICTR74
Project tigm

Sequence tag IST14249H1HMR1
Sequence
GAATAGCTTAAATAATTTGCCTAATTTTACACTAGTAAGTAGTGGAGCTAGTATTTTATTTCTGACTTAGGTTTCTAATG
TTC
Sequence Type genomic DNA
Unitrap ID UNI15534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119612490..119612571 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034032 (Rpap1) NM_177294 RNA polymerase II associated protein 1 Gene [Source:MGI (curated);Acc:Rpap1-006]

 
Come back to gene ENSMUSG00000034032


For any suggestions or comments, please send an email to unitrap@crg.es