Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14829C12
Clone ID IST14829C12
Vector VICTR76
Project tigm

Sequence tag IST14829C12BBF1
Sequence
GGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTTGAAAAAACAACAAACAAACAAACAAC
AACAAACACTAAAACAAACAGACAAACAAAACCCCACCAAAGTTGTCGATTTAAGTCAGGATGACGTAGCTCACTTGACA
CTATCACCTATGCTTAAGANAACTCTAGGGACTAGAGAAATGGCTCAGTGGTTAANAGCACACACCGCTCATGTTANATA
CCTCACAACCNCCTATAANTGCAGCTCCNGGGAGCTCCAAAGTCTCTGGCCTCCAAAAGCACCTATAATCACACACATAT
ACCTACACACACCCANCCCCACGGANACNTGAATATNCACATAATTNAAAAGCTCTTTGANTANANNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90918597..90918979 359
NO GENE  


Sequence tag IST14829C12HMF1
Sequence
CAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTTGAAAAAACAACAAACAAACAAACAACAACAAA
CACTAAAACAAACAGACAAACAAAACCCCACCAAAGTTGTCGATTTAAGTCAGGATGACGTAGCTCACTTGACACTATCA
CCTATGCTTAAGAGAACTCTAGGGACTAGAGAAATGGCTCAGTGGTTAAGAGCACACACCGCTCATGTTAGATAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90918740..90918973 234
NO GENE  


Sequence tag IST14829C12HMR1
Sequence
ATCCGCCTGCCTCTGCCTCCCNAGNGCTGGGATCAAAGGCGTGTGCCACCACNCCCGGCTAANACTGGTATTTTTATTCC
NTCCTGTGAACCACTGTTTCTCAAGTTATGGTCCCCATACCTGCAGCATTAGAATTACCAAGAAGCTCACTAAAAATGCA
AATGCAAGCCCCACCTCANACCTGCAAAATTTGATTTTTGGATCTGTCATGGGACCTATAGTTTTCACTCCTAANACATT
GCTGGCTGGTGATTCTGTTGTTGTCCNCTGCTNNTCTGTGGN
Sequence Type genomic DNA
Unitrap ID UNI15375

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90919001..90919281 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es