Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14220D6
Clone ID IST14220D6
Vector VICTR74
Project tigm

Sequence tag IST14220D6HMR1
Sequence
GTCCCAGACTTTTTTCTTCNAGGCAGGGTTTTCCTTTTTAGACCTCACTATCTGGGCCNCGACCTGGCTAGAAACTTTTT
TTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI18390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64017920..64018011 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032400 (Zwilch) NM_026507 Zwilch, kinetochore associated, homolog (Drosophila) Gene [Source:MGI (curated);Acc:Zwilch-001]


Sequence tag IST14220D6HMF1
Sequence
GGGACTTATTAAAAAAAGAGAGAGAGAGAGAGATTTGCCCTTTTAATTAGGGATTTGGGGTGAGCATGTAACTTTANAGG
CCAGAATAGGACACTGCACCCTCTCACCACAGCTGGAGTTGTGGAGAGCTGTGGATCACCANAAGTCACCACAGCTGGAG
TTGTGTGGAGAGCTGTGGATCACTAGAAGTGCTGCTCTTCACTGCTCAGCTGCTTCATAAGGCATTTANTAGTGATCTCA
AAGTACACAAATTATAAAACACTGGCCGACTCAAATAAATTACCAAAATGTATTGCCAGCCTGAGCTATAGGGAAAGTAG
CTCTAGTTACTGAAAGAGCCCAACAGTTATATCANAATAGTTCGCATCTTTTGATCTGATACTTGACCTAATTGATCTAN
ANNCNAAAAACAAGCCTGATNNGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64018007..64018431 405
 
EST/CDNA Est Name
  CA479728.1 - CA461899.1 - CA467257.1 - CA469399.1 - CA490910.1 - CA460350.1 - CA492473.1 - CA492207.1 - CA460084.1 - AA637960.1 - DT917993.1 - CD770453.1 - CD561823.1 - BB655115.1 - CN672487.1 - BG078097.2 - CF165762.1 - CN695596.1 - CF164679.1 - CF163568

 
Come back to gene CA479728.1 - CA461899.1 - CA467257.1 - CA469399.1 - CA490910.1 - CA460350.1 - CA492473.1 - CA492207.1 - CA460084.1 - AA637960.1 - DT917993.1 - CD770453.1 - CD561823.1 - BB655115.1 - CN672487.1 - BG078097.2 - CF165762.1 - CN695596.1 - CF164679.1 - CF163568


For any suggestions or comments, please send an email to unitrap@crg.es