Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14367E8
Clone ID IST14367E8
Vector VICTR74
Project tigm

Sequence tag IST14367E8BBF1
Sequence
CCTCAACTGAAGCTCCTTTCTCTGTGATAACTCCAGCTGTGTCAAGTTGACACAAAACTAGCCAGTACAGCACCTAAGCC
AACCTACCAGGATATTGCCAATTTTTATTTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTGAAGCTCGT
GAGTCNNNGTTCTGAATCCAGCNNGTGCCAATGTGTGCANAANGCCCCTGTGAAAAGGANTANAGAGTANACGTTACCGG
CNNGGANAGGTTCATGGNTTNNANAATTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14367E8HMF1
Sequence
CCTCAACTGAAGCTCCTTTCTCTGTGATAACTCCAGCTGTGTCAAGTTCC
Sequence Type genomic DNA
Unitrap ID UNI33950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 69831919..69831967 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 31244085..31244133 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14432608..14432656 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056296 (Synpr) NM_028052 synaptoporin Gene [Source:MGI (curated);Acc:Synpr-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 68504810..68504858 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 150234854..150234902 49
NO GENE  

 
Come back to gene ENSMUSG00000056296


For any suggestions or comments, please send an email to unitrap@crg.es