Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14346E7
Clone ID IST14346E7
Vector VICTR74
Project tigm

Sequence tag IST14346E7HMR1
Sequence
ACATGTAGCCNACCNTCCNTAANTTGAGACNNGTGTGTGGACAGGGTTGAGAGTCNTACAGAAAGCTAATTTAAGAGAGT
CCATGGGCAAGGTTGAGGACATGAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14346E7HMF1
Sequence
ATGTCACTTGACAGGCCTGGCAACTCCATTCATAGGCATATTACATGGGAGAAACTCTTGTGCCCTGAGTTCTGGGAGAT
ACACTGTAACAATCATACAGAATTGAAGTGATGGGCTGGAGAGATGGCTTAGCCGTTAAGAGCATTTGCTGTTCTTACAG
AGGACACAGGTTCCATGCCCAGCACCCACATGACAGCTCACAACTGTTGATCACTCCAATTCCAGGGTCTCCAACACCCT
CCTCTACCTCCATAAACTCCAGGACTGCATGTGGTGCACAGAGAGATATATGAGCTTAAAATAACTCTAAAAACTTTAAA
AAAAAAANANTTAAANGGAACTTGTATTTGGTTATCNATTACTGTGTACAAATTACCATCAATGNNAAGGCTN
Sequence Type genomic DNA
Unitrap ID UNI32360

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130996011..130996402 380
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027329 (Spef1) NM_027641 sperm flagellar 1 Gene [Source:MGI (curated);Acc:Spef1-001]

 
Come back to gene ENSMUSG00000027329


For any suggestions or comments, please send an email to unitrap@crg.es