Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0685
Clone ID AC0685
Vector pGT0lxr
Project sanger

Sequence tag AC0685
Sequence
AGTATCAGATCTCCCGGAAATGCAGTTTCACACCGCTGTGAGCTGTCATGTGGGAGCTGGGAATTGAACCTAGGTCCTCT
GCAAGAGCAGTCAGTGCTGTTTACAGCAGAACCATGTCCAGCCCCATTAATATTTTTATGTGTGTCTTGCCTGCAGTTGC
CAGAAGAGGGCATCGGAGAGCCTCTCTCTCCCGCCTCCGAGCGGGCCATGCGGACGGCTGGAGACCCGGGACCCCACGGC
CCTGCGCTCGTCCCTCGCGCCGCGGTAGCCCGGAGCCCGCGGGCCTAGCGGCGGCCTTTGTTCCCTGCGTCGCCGTCTGC
CGAGCTCCGGCCGGCGCGGATGCAGCTGCTCCGCCTGGGCTCGCGCTCGGGGCAGGAGGAGGAGCGGCGGCTCCGGGCGG
CATGCGATGGGGAACTGCTGCTGGACGCAATGCTTCGGGCTGCTCAACCGGGAAGCGGGTCGGCTGCAGCGAGCGGGCGG
AGGTCTCCAAGTGG
Sequence Type mRNA
Unitrap ID UNI2948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 127540067..127540352 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074238 (BC002199) NM_145964 BC002199 protein [Source:UniProtKB/TrEMBL;Acc:Q99LV9]

 
Come back to gene ENSMUSG00000074238


For any suggestions or comments, please send an email to unitrap@crg.es