Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14228A9
Clone ID IST14228A9
Vector VICTR74
Project tigm

Sequence tag IST14228A9HMR1
Sequence
NAATATTATGCAGCTGTTNNGGTTATAATTTGAAAAACTGGCTATGTGAAAATGCTTTGGTAGAAGTATTTCCTTGTATT
GGTGAGAAGAATCAGTGTATGGTGGGAAGAACATGGCTTCTGGCACATCAGGGTTTGACATCTAGTGTTGATACTTTCTA
ACTGAGACTACTTAGGTCAGTTCCTTCATCTGCTTGACTATCACTTCTTTATGANTCNTATATTAACATANTCTGTTGGT
CC
Sequence Type genomic DNA
Unitrap ID UNI15236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108514006..108514246 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


Sequence tag IST14228A9BBF1
Sequence
ATTCCATCTAGTGGAAGAAAACAAATTTTCTTCATTACTTCTTTATTCTGTAAGATATAGGTAACATAGAAGTTACCAAT
TATTATTTTATTACTTTGCCTGTTTTTGTATTATTGACTATTTGTCTACTTAGGTCCTCTGTCTCTTCCAAATTTTGTTT
ACTGTGATTTGTTCCATAGCTTCTGGGTTTATGGCTACAATTANTCNATATGANTTGAGCCTTATCATGGTAAATGTGTT
GTTTNNNAANAAAGGGTTNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108513751..108514008 244
 
EST/CDNA Est Name
  DT912388.1 - AA110874.1

 
Come back to gene DT912388.1 - AA110874.1


For any suggestions or comments, please send an email to unitrap@crg.es