Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14442C4
Clone ID IST14442C4
Vector VICTR74
Project tigm

Sequence tag IST14442C4BBF1
Sequence
ATAGCAATTCAAGGACGGGACAGAATTTAGGGACTCGGTATCAAGACCAAACAACAACAACAAAATGCCAGGTGTGGTGG
GACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 43201036..43201124 89
NO GENE  


Sequence tag IST14442C4HMF1
Sequence
ATAGCAATTCAAGGACGGGACAGAATTTAGGGACTCGGTATCAAGACCAAACAACAACAACAAAATGCCAGGTGTGGTGG
GACAGATCTTTAATCCTAGCATTTGGTCGGTTTAGGCAGCTGGATCTCCAAGGCCAGCCTTGTTAAATCTCAGGCTCCAG
GCCATTCAAAGCTACAGTGAAATGTANACTTAAAACAAACAAACAAACAAACAAGGCATCTCTAGTAAAGCCCAAAGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 43200887..43201124 236
NO GENE  


Sequence tag IST14442C4HMR1
Sequence
CTATGTAAACCNGGCTGGCCTCAAACTTAGAGATCTGACTGATCCTGCCTGTAGGGGGTGGAGGTGGGATGGNGGTGGGN
Sequence Type genomic DNA
Unitrap ID UNI29669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 43201121..43201199 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038214 (AK122525) NM_199028 BEN domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2677212]

 
Come back to gene ENSMUSG00000038214


For any suggestions or comments, please send an email to unitrap@crg.es