Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14678G7
Clone ID IST14678G7
Vector VICTR74
Project tigm

Sequence tag IST14678G7HMF1
Sequence
CTACTACGACCTAGGTGCCGAGTCCGTCGGAGGCTCCTTTGCCGGCCGACCCTTTAAGGCTAGCAGTAAAGCCCCTCGCA
GTCTTTCGTTCGTAGAGCTAGGGGGAGTGCAGGCTGCCAGGCGGACAGCCTTACAGGTCACCGTGTAAGACGAGGGGGTT
CCTGCATTCCTCTCGTGAGGGGCCTGGTACTTTCGTTGTAAAGCTCTGGTTTTCTTGGGGAACACAACGGCTGANCGCAG
TANGTGCGCTGTCTTTACTCTTCCCCNTTCCNNCCCANGGCCGANNAGGGTTAANACTCNNCTGCGGCATCTTGA
Sequence Type genomic DNA
Unitrap ID UNI35503

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23566133..23566446 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020280 (Pus10) NM_001033654 pseudouridylate synthase 10 Gene [Source:MGI (curated);Acc:Pus10-004]


Sequence tag IST14678G7HMR1
Sequence
GTAGCTGCTGCCAGAAACGTCGATGAGCCCCTACTCAAATTTGAAACCCAGANTAGGGAAAAGAAAGAGGGACGTCCCGC
TCTCCCGACTCCCGACCCCCTCCCACACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23566028..23566136 107
NO GENE  


Sequence tag IST14678G7BBF1
Sequence
CTACTACGACCTAGGTGCCGAGTCCGTCGGAGGCTCCTTTGCCGGCCGACCCTTTAAGGCTAGCAGTAAAGCCCCTCGCA
GTCTTTCGTTCGTAGAGCTAGGGGGAGTGCAGGCTGCCAGGCGGACAGCCTTACAGGTCACCGTGTAAGACGAGGGGGTT
CCTGCATTCCTCTCGTGAGGGGCCTGGTACTTTCGTTGTAAAGCTCTGGTTTTCTTGGGGAACACANCGGCTGAGCGCAN
TANGTGCGCTGTCTTTACNNNNCCCNNTTCCCACCNANGGCCNANNAGGGTTAANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020280


For any suggestions or comments, please send an email to unitrap@crg.es