Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14378G3
Clone ID IST14378G3
Vector VICTR74
Project tigm

Sequence tag IST14378G3BBF1
Sequence
GCTGTCTTCAGACACAACAGAAGAAGGCATCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 36593425..36593461 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168585847..168585883 37
NO GENE  


Sequence tag IST14378G3HMR1
Sequence
CAGCTACAGTGTACTTACATATAATAAGTAAATAAATCTTAAAAAAAAAAANAN
Sequence Type genomic DNA
Unitrap ID UNI4185 UNI35504

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72751010..72751060 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 34056445..34056495 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8778621..8778671 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168585800..168585850 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95296873..95296923 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44297551..44297601 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 135050735..135050785 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3226411..3226461 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 48737045..48737095 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 306834..306884 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12174647..12174697 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031007 (Atp6ap2) NM_027439 ATPase, H+ transporting, lysosomal accessory protein 2 Gene [Source:MGI (curated);Acc:Atp6ap2-001]

 
Come back to gene ENSMUSG00000031007


For any suggestions or comments, please send an email to unitrap@crg.es